Source code for pydna.assembly2

# -*- coding: utf-8 -*-
"""
Improved implementation of the assembly module. To see a list of issues with the previous implementation,
see [issues tagged with fixed-with-new-assembly-model](https://github.com/pydna-group/pydna/issues?q=is%3Aissue%20state%3Aopen%20label%3Afixed-with-new-assembly-model)
"""

import networkx as nx
import itertools
from Bio.SeqFeature import SimpleLocation, Location

from Bio.Restriction.Restriction import RestrictionBatch
import regex
import copy

from pydna.utils import (
    shift_location,
    flatten,
    location_boundaries,
    locations_overlap,
    sum_is_sticky,
    limit_iterator,
    create_location,
)
from pydna._pretty import pretty_str as ps
from pydna.common_sub_strings import common_sub_strings as common_sub_strings_str
from pydna.dseqrecord import Dseqrecord
from pydna.dseq import Dseq
from pydna.primer import Primer
from pydna.seqrecord import SeqRecord
from pydna.types import (
    CutSiteType,
    # TODO: allow user to enforce multi-site
    EdgeRepresentationAssembly,
    SubFragmentRepresentationAssembly,
    AssemblyAlgorithmType,
    SequenceOverlap,
    AssemblyEdgeType,
)
from pydna.gateway import gateway_overlap, find_gateway_sites
from pydna.cre_lox import cre_loxP_overlap
from pydna.alphabet import anneal_strands
from pydna.recombinase import Recombinase

from typing import TYPE_CHECKING, Callable, Literal
from pydna.opencloning_models import (
    AssemblySource,
    RestrictionAndLigationSource,
    GibsonAssemblySource,
    InFusionSource,
    OverlapExtensionPCRLigationSource,
    InVivoAssemblySource,
    LigationSource,
    GatewaySource,
    HomologousRecombinationSource,
    CreLoxRecombinationSource,
    RecombinaseSource,
    PCRSource,
    SourceInput,
    CRISPRSource,
)
from pydna.crispr import cas9
import warnings

if TYPE_CHECKING:  # pragma: no cover
    from Bio.Restriction import AbstractCut


[docs] def gather_overlapping_locations( locs: list[Location], fragment_length: int ) -> list[tuple[Location, ...]]: """ Turn a list of locations into a list of tuples of those locations, where each tuple contains locations that overlap. For example, if locs = [loc1, loc2, loc3], and loc1 and loc2 overlap, the output will be [(loc1, loc2), (loc3,)]. """ # Make a graph with all the locations as nodes G = nx.Graph() for i, loc in enumerate(locs): G.add_node(i, location=loc) # Add edges between nodes that overlap for i in range(len(locs)): for j in range(i + 1, len(locs)): if locations_overlap(locs[i], locs[j], fragment_length): G.add_edge(i, j) # Get groups of overlapping locations groups = list() for loc_set in nx.connected_components(G): groups.append(tuple(locs[i] for i in loc_set)) # Sort by location of the first element in each group (does not matter which since they are overlapping) groups.sort(key=lambda x: location_boundaries(x[0])[0]) return groups
[docs] def ends_from_cutsite( cutsite: CutSiteType, seq: Dseq ) -> tuple[tuple[str, str], tuple[str, str]]: """Get the sticky or blunt ends created by a restriction enzyme cut. Parameters ---------- cutsite : CutSiteType A tuple ((cut_watson, ovhg), enzyme) describing where the cut occurs seq : _Dseq The DNA sequence being cut Raises ------ ValueError If cutsite is None Returns ------- tuple[tuple[str, str], tuple[str, str]] A tuple of two tuples, each containing the type of end ('5\'', '3\'', or 'blunt') and the sequence of the overhang. The first tuple is for the left end, second for the right end. >>> from Bio.Restriction import NotI >>> x = Dseq("ctcgGCGGCCGCcagcggccg") >>> x.get_cutsites(NotI) [((6, -4), NotI)] >>> ends_from_cutsite(x.get_cutsites(NotI)[0], x) (("5'", 'ggcc'), ("5'", 'ggcc')) """ if cutsite is None: raise ValueError("None is not supported") cut_watson, cut_crick, ovhg = seq.get_cut_parameters(cutsite, is_left=None) if ovhg < 0: # TODO check the edge in circular return ( ("5'", str(seq[cut_watson:cut_crick].reverse_complement()).lower()), ("5'", str(seq[cut_watson:cut_crick]).lower()), ) elif ovhg > 0: return ( ("3'", str(seq[cut_crick:cut_watson]).lower()), ("3'", str(seq[cut_crick:cut_watson].reverse_complement()).lower()), ) return ("blunt", ""), ("blunt", "")
[docs] def restriction_ligation_overlap( seqx: Dseqrecord, seqy: Dseqrecord, enzymes=RestrictionBatch, partial=False, allow_blunt=False, ) -> list[SequenceOverlap]: """Assembly algorithm to find overlaps that would result from restriction and ligation. Like in sticky and gibson, the order matters (see example below of partial overlap) Parameters ---------- seqx : Dseqrecord The first sequence seqy : Dseqrecord The second sequence enzymes : RestrictionBatch The enzymes to use partial : bool Whether to allow partial overlaps allow_blunt : bool Whether to allow blunt ends Returns ------- list[SequenceOverlap] A list of overlaps between the two sequences >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.assembly2 import restriction_ligation_overlap >>> from Bio.Restriction import EcoRI, RgaI, DrdI, EcoRV >>> x = Dseqrecord("ccGAATTCaa") >>> y = Dseqrecord("aaaaGAATTCgg") >>> restriction_ligation_overlap(x, y, [EcoRI]) [(3, 5, 4)] >>> restriction_ligation_overlap(y, x, [EcoRI]) [(5, 3, 4)] Partial overlap, note how it is not symmetric >>> x = Dseqrecord("GACTAAAGGGTC") >>> y = Dseqrecord("AAGCGATCGCAAGCGATCGCAA") >>> restriction_ligation_overlap(x, y, [RgaI, DrdI], partial=True) [(6, 5, 1), (6, 15, 1)] >>> restriction_ligation_overlap(y, x, [RgaI, DrdI], partial=True) [] Blunt overlap, returns length of the overlap 0 >>> x = Dseqrecord("aaGATATCcc") >>> y = Dseqrecord("ttttGATATCaa") >>> restriction_ligation_overlap(x, y, [EcoRV], allow_blunt=True) [(5, 7, 0)] >>> restriction_ligation_overlap(y, x, [EcoRV], allow_blunt=True) [(7, 5, 0)] """ cuts_x = seqx.seq.get_cutsites(*enzymes) cuts_y = seqy.seq.get_cutsites(*enzymes) # If blunt ends are allowed, something similar to this could be done to allow # joining with linear sequence ends, but for now it messes up with the only_adjacent_edges # case # if allow_blunt: # if not seqx.circular: # cuts_x.append(((len(seqx), 0), None)) # if not seqy.circular: # cuts_y.append(((0, 0), None)) matches = list() for cut_x, cut_y in itertools.product(cuts_x, cuts_y): # A blunt end if allow_blunt and cut_x[0][1] == cut_y[0][1] == 0: matches.append((cut_x[0][0], cut_y[0][0], 0)) continue # Otherwise, test overhangs overlap = sum_is_sticky( ends_from_cutsite(cut_x, seqx.seq)[0], ends_from_cutsite(cut_y, seqy.seq)[1], partial, ) if not overlap: continue x_watson, x_crick, x_ovhg = seqx.seq.get_cut_parameters(cut_x, is_left=False) y_watson, y_crick, y_ovhg = seqy.seq.get_cut_parameters(cut_y, is_left=True) # Positions where the overlap would start for full overlap left_x = x_watson if x_ovhg < 0 else x_crick left_y = y_watson if y_ovhg < 0 else y_crick # Correct por partial overlaps left_x += abs(x_ovhg) - overlap matches.append((left_x, left_y, overlap)) return matches
[docs] def combine_algorithms(*algorithms: AssemblyAlgorithmType) -> AssemblyAlgorithmType: """ Combine assembly algorithms, if any of them returns a match, the match is returned. This can be used for example in a ligation where you want to allow both sticky and blunt end ligation. """ def combined(seqx, seqy, limit): matches = list() for algorithm in algorithms: matches += algorithm(seqx, seqy, limit) return matches return combined
[docs] def blunt_overlap( seqx: Dseqrecord, seqy: Dseqrecord, limit=None ) -> list[SequenceOverlap]: """ Assembly algorithm to find blunt overlaps. Used for blunt ligation. It basically returns [(len(seqx), 0, 0)] if the right end of seqx is blunt and the left end of seqy is blunt (compatible with blunt ligation). Otherwise, it returns an empty list. Parameters ---------- seqx : Dseqrecord The first sequence seqy : Dseqrecord The second sequence limit : int There for compatibility, but it is ignored Returns ------- list[SequenceOverlap] A list of overlaps between the two sequences >>> from pydna.assembly2 import blunt_overlap >>> from pydna.dseqrecord import Dseqrecord >>> x = Dseqrecord("AAAAAA") >>> y = Dseqrecord("TTTTTT") >>> blunt_overlap(x, y) [(6, 0, 0)] """ if ( seqx.seq.three_prime_end()[0] == "blunt" and seqy.seq.five_prime_end()[0] == "blunt" ): return [(len(seqx), 0, 0)] return []
[docs] def common_sub_strings( seqx: Dseqrecord, seqy: Dseqrecord, limit=25 ) -> list[SequenceOverlap]: """ Assembly algorithm to find common substrings of length == limit. see the docs of the function common_sub_strings_str for more details. It is case insensitive. >>> from pydna.dseqrecord import Dseqrecord >>> x = Dseqrecord("TAAAAAAT") >>> y = Dseqrecord("CCaAaAaACC") >>> common_sub_strings(x, y, limit=5) [(1, 2, 6), (1, 3, 5), (2, 2, 5)] """ query_seqx = str(seqx.seq).upper() query_seqy = str(seqy.seq).upper() if seqx.circular: query_seqx = query_seqx * 2 if seqy.circular: query_seqy = query_seqy * 2 results = common_sub_strings_str(query_seqx, query_seqy, limit) if not seqx.circular and not seqy.circular: return results # Remove matches that start on the second copy of the sequence if seqx.circular: results = [r for r in results if r[0] < len(seqx)] if seqy.circular: results = [r for r in results if r[1] < len(seqy)] # Trim lengths that span more than the sequence if seqx.circular or seqy.circular: max_match_length = min(len(seqx), len(seqy)) results = [(r[0], r[1], min(r[2], max_match_length)) for r in results] # Edge case where the sequences are identical if len(seqx.seq) == len(seqy.seq): full_match = next((r for r in results if r[2] == len(seqx.seq)), None) if full_match is not None: return [full_match] # Remove duplicate matches, see example below # Let's imagine the following two sequences, where either seqy or both are circular # seqx: 01234 # seqy: 123450, circular # # common_sub_strings would return [(0, 5, 5), (1, 0, 4)] # Actually, (1, 0, 4) is a subset of (0, 5, 5), the part # that does not span the origin. To remove matches like this, # We find matches where the origin is spanned in one of the sequences # only, and then remove the subset of that match that does not span the origin. shifted_matches = set() for x, y, length in results: x_span_origin = seqx.circular and x + length > len(seqx) y_span_origin = seqy.circular and y + length > len(seqy) if x_span_origin and not y_span_origin: shift = len(seqx) - x shifted_matches.add((0, y + shift, length - shift)) elif not x_span_origin and y_span_origin: shift = len(seqy) - y shifted_matches.add((x + shift, 0, length - shift)) return [r for r in results if r not in shifted_matches]
def _get_trim_end_info( end_info: tuple[str, str], trim_ends: str, is_five_prime: bool ) -> int | None: """Utility function to get the trim information for terminal_overlap.""" if end_info[0] == trim_ends: return len(end_info[1]) if is_five_prime else len(end_info[1]) * -1 return 0 if is_five_prime else None
[docs] def terminal_overlap( seqx: Dseqrecord, seqy: Dseqrecord, limit=25, trim_ends: None | str = None ): """ Assembly algorithm to find terminal overlaps (e.g. for Gibson assembly). The order matters, we want alignments like: :: seqx: oooo------xxxx seqy: xxxx------oooo Product: oooo------xxxx------oooo Not like: seqx: oooo------xxxx seqy: xxxx------oooo Product (unwanted): oooo Parameters ---------- seqx : Dseqrecord The first sequence seqy : Dseqrecord The second sequence limit : int Minimum length of the overlap trim_ends : str The ends to trim, either '5' or '3' If None, no trimming is done Returns ------- list[SequenceOverlap] A list of overlaps between the two sequences >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.assembly2 import terminal_overlap >>> x = Dseqrecord("ttactaAAAAAA") >>> y = Dseqrecord("AAAAAAcgcacg") >>> terminal_overlap(x, y, limit=5) [(6, 0, 6), (7, 0, 5)] >>> terminal_overlap(y, x, limit=5) [] Trimming the ends: >>> from pydna.dseq import Dseq >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.assembly2 import terminal_overlap >>> x = Dseqrecord(Dseq.from_full_sequence_and_overhangs("aaaACGT", 0, 3)) >>> y = Dseqrecord(Dseq.from_full_sequence_and_overhangs("ACGTccc", 3, 0)) >>> terminal_overlap(x, y, limit=4) [(3, 0, 4)] >>> terminal_overlap(x, y, limit=4, trim_ends="5'") [(3, 0, 4)] >>> terminal_overlap(x, y, limit=4, trim_ends="3'") [] """ if trim_ends is not None and trim_ends not in ["5'", "3'"]: raise ValueError("trim_ends must be '5' or '3'") if trim_ends is None: trim_x_left, trim_x_right, trim_y_left, trim_y_right = (0, None, 0, None) stringx = str(seqx.seq).upper() stringy = str(seqy.seq).upper() else: trim_x_right = _get_trim_end_info( seqx.seq.three_prime_end(), trim_ends, is_five_prime=False ) trim_y_left = _get_trim_end_info( seqy.seq.five_prime_end(), trim_ends, is_five_prime=True ) # I actually don't think these two are needed, since only the terminal # join between x_right and y_left is tested, but maybe there is some edge-case # that I am missing, so keeping them just in case. trim_x_left = _get_trim_end_info( seqx.seq.five_prime_end(), trim_ends, is_five_prime=True ) trim_y_right = _get_trim_end_info( seqy.seq.three_prime_end(), trim_ends, is_five_prime=False ) stringx = str(seqx.seq[trim_x_left:trim_x_right]).upper() stringy = str(seqy.seq[trim_y_left:trim_y_right]).upper() # We have to convert to list because we need to modify the matches matches = [ list(m) for m in common_sub_strings_str(stringx, stringy, limit) if (m[1] == 0 and m[0] + m[2] == len(stringx)) ] # Shift the matches if the left end has been trimmed for match in matches: match[0] += trim_x_left match[1] += trim_y_left # convert to tuples again return [tuple(m) for m in matches]
[docs] def gibson_overlap(seqx: Dseqrecord, seqy: Dseqrecord, limit=25): """ Assembly algorithm to find terminal overlaps for Gibson assembly. It is a wrapper around terminal_overlap with trim_ends="5'". """ return terminal_overlap(seqx, seqy, limit, trim_ends="5'")
[docs] def in_fusion_overlap(seqx: Dseqrecord, seqy: Dseqrecord, limit=25): """ Assembly algorithm to find terminal overlaps for in-fusion assembly. It is a wrapper around terminal_overlap with trim_ends="3'". """ return terminal_overlap(seqx, seqy, limit, trim_ends="3'")
[docs] def pcr_fusion_overlap(seqx: Dseqrecord, seqy: Dseqrecord, limit=25): """ Assembly algorithm to find terminal overlaps for PCR fusion assembly. It is a wrapper around terminal_overlap with trim_ends=None. """ return terminal_overlap(seqx, seqy, limit, trim_ends=None)
[docs] def sticky_end_sub_strings(seqx: Dseqrecord, seqy: Dseqrecord, limit: bool = False): """ Assembly algorithm for ligation of sticky ends. For now, if limit 0 / False (default) only full overlaps are considered. Otherwise, partial overlaps are also returned. Parameters ---------- seqx : Dseqrecord The first sequence seqy : Dseqrecord The second sequence limit : bool Whether to allow partial overlaps Returns ------- list[SequenceOverlap] A list of overlaps between the two sequences Ligation of fully overlapping sticky ends, note how the order matters >>> from pydna.dseq import Dseq >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.assembly2 import sticky_end_sub_strings >>> x = Dseqrecord(Dseq.from_full_sequence_and_overhangs("AAAAAA", 0, 3)) >>> y = Dseqrecord(Dseq.from_full_sequence_and_overhangs("AAAAAA", 3, 0)) >>> sticky_end_sub_strings(x, y, limit=False) [(3, 0, 3)] >>> sticky_end_sub_strings(y, x, limit=False) [] Ligation of partially overlapping sticky ends, specified with limit=True >>> x = Dseqrecord(Dseq.from_full_sequence_and_overhangs("AAAAAA", 0, 2)) >>> y = Dseqrecord(Dseq.from_full_sequence_and_overhangs("AAAAAA", 3, 0)) >>> sticky_end_sub_strings(x, y, limit=False) [] >>> sticky_end_sub_strings(x, y, limit=True) [(4, 0, 2)] """ overlap = sum_is_sticky( seqx.seq.three_prime_end(), seqy.seq.five_prime_end(), limit ) if overlap: return [(len(seqx) - overlap, 0, overlap)] return []
[docs] def zip_match_leftwards( seqx: SeqRecord, seqy: SeqRecord, match: SequenceOverlap ) -> SequenceOverlap: """ Starting from the rightmost edge of the match, return a new match encompassing the max number of bases. This can be used to return a longer match if a primer aligns for longer than the limit or a shorter match if there are mismatches. This is convenient to maintain as many features as possible. It is used in PCR assembly. >>> seq = Dseqrecord('AAAAACGTCCCGT') >>> primer = Dseqrecord('ACGTCCCGT') >>> match = (13, 9, 0) # an empty match at the end of each >>> zip_match_leftwards(seq, primer, match) (4, 0, 9) Works in circular molecules if the match spans the origin: >>> seq = Dseqrecord('TCCCGTAAAAACG', circular=True) >>> primer = Dseqrecord('ACGTCCCGT') >>> match = (6, 9, 0) >>> zip_match_leftwards(seq, primer, match) (10, 0, 9) """ query_x = seqrecord2_uppercase_DNA_string(seqx) query_y = seqrecord2_uppercase_DNA_string(seqy) # In circular sequences, the match may go beyond the left-most edge of the sequence if it spans # the origin: # Primer: ACGTCCCGT # ||||||||| # Circular seq: ACGTCCCGT -> Equivalent to Dseqrecord('CCCGTACGT', circular=True) # ^ # Origin # We would start from the last T and move leftwards, but we would stop at the origin # For those cases we shift by length, then go back end_on_x = match[0] + match[2] if isinstance(seqx, Dseqrecord) and seqx.circular and end_on_x <= len(seqx): end_on_x += len(seqx) end_on_y = match[1] + match[2] if isinstance(seqy, Dseqrecord) and seqy.circular and end_on_y <= len(seqy): end_on_y += len(seqy) count = 0 for x, y in zip(reversed(query_x[:end_on_x]), reversed(query_y[:end_on_y])): if x != y: break count += 1 # Shift back by length if needed start_on_x = (end_on_x - count) % len(seqx) start_on_y = (end_on_y - count) % len(seqy) return (start_on_x, start_on_y, count)
[docs] def zip_match_rightwards( seqx: Dseqrecord, seqy: Dseqrecord, match: SequenceOverlap ) -> SequenceOverlap: """Same as zip_match_leftwards, but towards the right.""" query_x = seqrecord2_uppercase_DNA_string(seqx) query_y = seqrecord2_uppercase_DNA_string(seqy) start_on_x, start_on_y, _ = match count = 0 for x, y in zip(query_x[start_on_x:], query_y[start_on_y:]): if x != y: break count += 1 return (start_on_x, start_on_y, count)
[docs] def seqrecord2_uppercase_DNA_string(seqr: SeqRecord) -> str: """ Transform a Dseqrecord to a sequence string where U is replaced by T, everything is upper case and circular sequences are repeated twice. This is used for PCR, to support primers with U's (e.g. for USER cloning). """ out = str(seqr.seq).upper().replace("U", "T") if isinstance(seqr, Dseqrecord) and seqr.circular: return out * 2 return out
[docs] def primer_template_overlap( seqx: Dseqrecord | Primer, seqy: Dseqrecord | Primer, limit=25, mismatches=0 ) -> list[SequenceOverlap]: """ Assembly algorithm to find overlaps between a primer and a template. It accepts mismatches. When there are mismatches, it only returns the common part between the primer and the template. If seqx is a primer and seqy is a template, it represents the binding of a forward primer. If seqx is a template and seqy is a primer, it represents the binding of a reverse primer, where the primer has been passed as its reverse complement (see examples). Parameters ---------- seqx : Dseqrecord | Primer The primer seqy : Dseqrecord | Primer The template limit : int Minimum length of the overlap mismatches : int Maximum number of mismatches (only substitutions, no deletion or insertion) Returns ------- list[SequenceOverlap] A list of overlaps between the primer and the template >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.primer import Primer >>> from pydna.assembly2 import primer_template_overlap >>> template = Dseqrecord("AATTAGCAGCGATCGAGT", circular=True) >>> primer = Primer("TTAGCAGC") >>> primer_template_overlap(primer, template, limit=8, mismatches=0) [(0, 2, 8)] This actually represents the binding of the primer ``GCTGCTAA`` (reverse complement) >>> primer_template_overlap(template, primer, limit=8, mismatches=0) [(2, 0, 8)] >>> primer_template_overlap(primer, template.reverse_complement(), limit=8, mismatches=0) [] >>> primer_template_overlap(primer.reverse_complement(), template, limit=8, mismatches=0) [] """ if isinstance(seqx, Primer) and isinstance(seqy, Dseqrecord): primer = seqx template = seqy reverse_primer = False elif isinstance(seqx, Dseqrecord) and isinstance(seqy, Primer): primer = seqy template = seqx reverse_primer = True else: raise ValueError( "One of the sequences must be a primer and the other a Dseqrecord" ) if len(primer) < limit: return [] subject = seqrecord2_uppercase_DNA_string(template) query = ( seqrecord2_uppercase_DNA_string(primer[:limit]) if reverse_primer else seqrecord2_uppercase_DNA_string(primer[-limit:]) ) re_matches = list( regex.finditer( "(" + query + "){s<=" + str(mismatches) + "}", subject, overlapped=True ) ) re_matches += list( regex.finditer( "(?r)(" + query + "){s<=" + str(mismatches) + "}", subject, overlapped=True ) ) out = set() for re_match in re_matches: start, end = re_match.span() # For circular sequences the same match is returned twice unless it falls # on the origin, we eliminate duplicates here if start >= len(template): continue # This extends match beyond the limit if the primer aligns more than that # and reduces the match if the primer has mismatches if reverse_primer: # Match in the same format as other assembly algorithms starting_match = (start, 0, end - start) out.add(zip_match_rightwards(template, primer, starting_match)) else: # Match in the same format as other assembly algorithms starting_match = (len(primer) - limit, start, end - start) out.add(zip_match_leftwards(primer, template, starting_match)) return list(sorted(out))
[docs] def reverse_complement_assembly( assembly: EdgeRepresentationAssembly, fragments: list[Dseqrecord] ) -> EdgeRepresentationAssembly: """Complement an assembly, i.e. reverse the order of the fragments and the orientation of the overlaps.""" new_assembly = list() for u, v, locu, locv in assembly: f_u = fragments[abs(u) - 1] f_v = fragments[abs(v) - 1] new_assembly.append((-v, -u, locv._flip(len(f_v)), locu._flip(len(f_u)))) return new_assembly[::-1]
[docs] def filter_linear_subassemblies( linear_assemblies: list[EdgeRepresentationAssembly], circular_assemblies: list[EdgeRepresentationAssembly], fragments: list[Dseqrecord], ) -> list[EdgeRepresentationAssembly]: """Remove linear assemblies which are sub-assemblies of circular assemblies""" all_circular_assemblies = circular_assemblies + [ reverse_complement_assembly(c, fragments) for c in circular_assemblies ] filtered_assemblies = [ assem for assem in linear_assemblies if not any(is_sublist(assem, c, True) for c in all_circular_assemblies) ] # I don't think the line below is necessary, but just in case # filtered_assemblies = [l for l in filtered_assemblies if not any(is_sublist(reverse_complement_assembly(l, fragments), c, True) for c in all_circular_assemblies)] return filtered_assemblies
[docs] def remove_subassemblies( assemblies: list[EdgeRepresentationAssembly], ) -> list[EdgeRepresentationAssembly]: """Filter out subassemblies, i.e. assemblies that are contained within another assembly. For example: [(1, 2, '1[8:14]:2[1:7]'), (2, 3, '2[10:17]:3[1:8]')] [(1, 2, '1[8:14]:2[1:7]')] The second one is a subassembly of the first one. """ # Sort by length, longest first assemblies = sorted(assemblies, key=len, reverse=True) filtered_assemblies = list() for assembly in assemblies: # Check if this assembly is a subassembly of any of the assemblies we have already found if not any(is_sublist(assembly, a) for a in filtered_assemblies): filtered_assemblies.append(assembly) return filtered_assemblies
[docs] def assembly2str(assembly: EdgeRepresentationAssembly) -> str: """Convert an assembly to a string representation, for example: ((1, 2, [8:14], [1:7]),(2, 3, [10:17], [1:8])) becomes: ('1[8:14]:2[1:7]', '2[10:17]:3[1:8]') The reason for this is that by default, a feature '[8:14]' when present in a tuple is printed to the console as ``SimpleLocation(ExactPosition(8), ExactPosition(14), strand=1)`` (very long). """ return str(tuple(f"{u}{lu}:{v}{lv}" for u, v, lu, lv in assembly))
[docs] def assembly2str_tuple(assembly: EdgeRepresentationAssembly) -> str: """Convert an assembly to a string representation, like ((1, 2, [8:14], [1:7]),(2, 3, [10:17], [1:8])) """ return str(tuple((u, v, str(lu), str(lv)) for u, v, lu, lv in assembly))
[docs] def assembly_has_mismatches( fragments: list[Dseqrecord], assembly: EdgeRepresentationAssembly ) -> bool: """Check if an assembly has mismatches. This should never happen and if so it returns an error.""" for u, v, loc_u, loc_v in assembly: seq_u = fragments[u - 1] if u > 0 else fragments[-u - 1].reverse_complement() seq_v = fragments[v - 1] if v > 0 else fragments[-v - 1].reverse_complement() # TODO: Check issue where extraction failed, and whether it would give problems here if ( str(loc_u.extract(seq_u).seq).upper() != str(loc_v.extract(seq_v).seq).upper() ): return True return False
[docs] def assembly_is_circular( assembly: EdgeRepresentationAssembly, fragments: list[Dseqrecord] ) -> bool: """ Based on the topology of the locations of an assembly, determine if it is circular. This does not work for insertion assemblies, that's why assemble takes the optional argument is_insertion. """ if assembly[0][0] != assembly[-1][1]: return False elif ( isinstance(fragments[abs(assembly[0][0]) - 1], Dseqrecord) and fragments[abs(assembly[0][0]) - 1].circular ): return True else: return ( location_boundaries(assembly[0][2])[0] > location_boundaries(assembly[-1][3])[0] )
[docs] def assemble( fragments: list[Dseqrecord], assembly: EdgeRepresentationAssembly, is_insertion: bool = False, ) -> Dseqrecord: """Generate a Dseqrecord from an assembly and a list of fragments.""" if is_insertion: is_circular = False else: is_circular = assembly_is_circular(assembly, fragments) subfragment_representation = edge_representation2subfragment_representation( assembly, is_circular ) # Sanity check for asm_edge in assembly: u, v, loc_u, loc_v = asm_edge f_u = fragments[u - 1] if u > 0 else fragments[-u - 1].reverse_complement() f_v = fragments[v - 1] if v > 0 else fragments[-v - 1].reverse_complement() seq_u = str(loc_u.extract(f_u).seq) seq_v = str(loc_v.extract(f_v).seq.reverse_complement()) # Test if seq_u and seq_v anneal if not anneal_strands(seq_u, seq_v): raise ValueError("Mismatch in assembly") # We transform into Dseqrecords (for primers) dseqr_fragments = [ f if isinstance(f, Dseqrecord) else Dseqrecord(f) for f in fragments ] subfragments = get_assembly_subfragments( dseqr_fragments, subfragment_representation ) # Length of the overlaps between consecutive assembly fragments fragment_overlaps = [len(e[-1]) for e in assembly] out_dseqrecord = subfragments.pop(0) for fragment, overlap in zip(subfragments, fragment_overlaps): out_dseqrecord.seq = out_dseqrecord.seq.cast_to_ds_right() out_dseqrecord.seq = out_dseqrecord.seq.exo1_end(overlap) fragment.seq = fragment.seq.cast_to_ds_left() fragment.seq = fragment.seq.exo1_front(overlap) out_dseqrecord += fragment # For circular assemblies, process the fragment and loop if is_circular: out_dseqrecord.seq = out_dseqrecord.seq.cast_to_ds_left() out_dseqrecord.seq = out_dseqrecord.seq.cast_to_ds_right() overlap = fragment_overlaps[-1] out_dseqrecord.seq = out_dseqrecord.seq.exo1_front(overlap) out_dseqrecord.seq = out_dseqrecord.seq.exo1_end(overlap) out_dseqrecord = out_dseqrecord.looped() out_dseqrecord.source = AssemblySource.from_subfragment_representation( subfragment_representation, fragments, is_circular ) return out_dseqrecord
[docs] def annotate_primer_binding_sites( input_dseqr: Dseqrecord, fragments: list[Dseqrecord] ) -> Dseqrecord: """Annotate the primer binding sites in a Dseqrecord.""" fwd, _, rvs = fragments start_rvs = len(input_dseqr) - len(rvs) output_dseqr = copy.deepcopy(input_dseqr) output_dseqr.add_feature( x=0, y=len(fwd), type_="primer_bind", strand=1, label=[fwd.name], note=["sequence: " + str(fwd.seq)], ) output_dseqr.add_feature( x=start_rvs, y=len(output_dseqr), type_="primer_bind", strand=-1, label=[rvs.name], note=["sequence: " + str(rvs.seq)], ) return output_dseqr
[docs] def edge_representation2subfragment_representation( assembly: EdgeRepresentationAssembly, is_circular: bool ) -> SubFragmentRepresentationAssembly: """ Turn this kind of edge representation fragment 1, fragment 2, right edge on 1, left edge on 2 a = [(1, 2, 'loc1a', 'loc2a'), (2, 3, 'loc2b', 'loc3b'), (3, 1, 'loc3c', 'loc1c')] Into this: fragment 1, left edge on 1, right edge on 1 b = [(1, 'loc1c', 'loc1a'), (2, 'loc2a', 'loc2b'), (3, 'loc3b', 'loc3c')] """ if is_circular: temp = list(assembly[-1:]) + list(assembly) else: temp = ( [(None, assembly[0][0], None, None)] + list(assembly) + [(assembly[-1][1], None, None, None)] ) edge_pairs = zip(temp, temp[1:]) subfragment_representation = list() for (_u1, v1, _, start_location), (_u2, _v2, end_location, _) in edge_pairs: subfragment_representation.append((v1, start_location, end_location)) return tuple(subfragment_representation)
[docs] def subfragment_representation2edge_representation( assembly: SubFragmentRepresentationAssembly, is_circular: bool ) -> EdgeRepresentationAssembly: """ Turn this kind of subfragment representation fragment 1, left edge on 1, right edge on 1 a = [(1, 'loc1c', 'loc1a'), (2, 'loc2a', 'loc2b'), (3, 'loc3b', 'loc3c')] Into this: fragment 1, fragment 2, right edge on 1, left edge on 2 b = [(1, 2, 'loc1a', 'loc2a'), (2, 3, 'loc2b' 'loc3b'), (3, 1, 'loc3c', 'loc1c')] """ edge_representation = [] # Iterate through the assembly pairwise to create the edge representation for i in range(len(assembly) - 1): frag1, left1, right1 = assembly[i] frag2, left2, right2 = assembly[i + 1] # Create the edge between the current and next fragment edge_representation.append((frag1, frag2, right1, left2)) if is_circular: # Add the edge from the last fragment back to the first frag_last, left_last, right_last = assembly[-1] frag_first, left_first, right_first = assembly[0] edge_representation.append((frag_last, frag_first, right_last, left_first)) return tuple(edge_representation)
[docs] def get_assembly_subfragments( fragments: list[Dseqrecord], subfragment_representation: SubFragmentRepresentationAssembly, ) -> list[Dseqrecord]: """From the fragment representation returned by edge_representation2subfragment_representation, get the subfragments that are joined together. Subfragments are the slices of the fragments that are joined together For example:: --A-- TACGTAAT --B-- TCGTAACGA Gives: TACGTAA / CGTAACGA To reproduce:: a = Dseqrecord('TACGTAAT') b = Dseqrecord('TCGTAACGA') f = Assembly([a, b], limit=5) a0 = f.get_linear_assemblies()[0] print(assembly2str(a0)) a0_subfragment_rep =edge_representation2subfragment_representation(a0, False) for f in get_assembly_subfragments([a, b], a0_subfragment_rep): print(f.seq) # prints TACGTAA and CGTAACGA Subfragments: ``cccccgtatcgtgt``, ``atcgtgtactgtcatattc`` """ subfragments = list() for node, start_location, end_location in subfragment_representation: seq = ( fragments[node - 1] if node > 0 else fragments[-node - 1].reverse_complement() ) subfragments.append(extract_subfragment(seq, start_location, end_location)) return subfragments
[docs] def extract_subfragment( seq: Dseqrecord, start_location: Location | None, end_location: Location | None ) -> Dseqrecord: """Extract a subfragment from a sequence for an assembly, given the start and end locations of the subfragment.""" if seq.circular and (start_location is None or end_location is None): raise ValueError( "Start and end locations cannot be None for circular sequences" ) # This could be used to have consistent behaviour for circular sequences, where the start is arbitrary. However, # they should never get None, so this is not used. # if start_location is None: # start_location = end_location # elif end_location is None: # end_location = start_location start = 0 if start_location is None else location_boundaries(start_location)[0] end = None if end_location is None else location_boundaries(end_location)[1] # Special case, some of it could be handled by better Dseqrecord slicing in the future if seq.circular and locations_overlap(start_location, end_location, len(seq)): # The overhang is different for origin-spanning features, for instance # for a feature join{[12:13], [0:3]} in a sequence of length 13, the overhang # is -4, not 9 ovhg = start - end if end > start else start - end - len(seq) # edge case if abs(ovhg) == len(seq): ovhg = 0 dummy_cut = ((start, ovhg), None) open_seq = seq.apply_cut(dummy_cut, dummy_cut) return Dseqrecord(open_seq.seq.cast_to_ds(), features=open_seq.features) return seq[start:end]
[docs] def is_sublist(sublist: list, my_list: list, my_list_is_cyclic: bool = False) -> bool: """Returns True if argument sublist is a sublist of argument my_list (can be treated as cyclic), False otherwise. Examples -------- >>> is_sublist([1, 2], [1, 2, 3], False) True >>> is_sublist([1, 2], [1, 3, 2], False) False # See the case here for cyclic lists >>> is_sublist([3, 1], [1, 2, 3], False) False >>> is_sublist([3, 1], [1, 2, 3], True) True """ n = len(sublist) if my_list_is_cyclic: my_list = my_list + my_list for i in range(len(my_list) - n + 1): # Just in case tuples were passed if list(my_list[i : i + n]) == list(sublist): return True return False
[docs] def circular_permutation_min_abs(lst: list) -> list: """Returns the circular permutation of lst with the smallest absolute value first. Examples -------- >>> circular_permutation_min_abs([1, 2, 3]) [1, 2, 3] >>> circular_permutation_min_abs([3, 1, 2]) [1, 2, 3] """ min_abs_index = min(range(len(lst)), key=lambda i: abs(lst[i])) return lst[min_abs_index:] + lst[:min_abs_index]
[docs] class Assembly: """Assembly of a list of DNA fragments into linear or circular constructs. Accepts a list of Dseqrecords (source fragments) to initiate an Assembly object. Several methods are available for analysis of overlapping sequences, graph construction and assembly. The assembly contains a directed graph, where nodes represent fragments and edges represent overlaps between fragments. : - The node keys are integers, representing the index of the fragment in the input list of fragments. The sign of the node key represents the orientation of the fragment, positive for forward orientation, negative for reverse orientation. - The edges contain the locations of the overlaps in the fragments. For an edge (u, v, key): - u and v are the nodes connected by the edge. - key is a string that represents the location of the overlap. In the format: 'u[start:end](strand):v[start:end](strand)'. - Edges have a 'locations' attribute, which is a list of two FeatureLocation objects, representing the location of the overlap in the u and v fragment, respectively. - You can think of an edge as a representation of the join of two fragments. If fragment 1 and 2 share a subsequence of 6bp, [8:14] in fragment 1 and [1:7] in fragment 2, there will be 4 edges representing that overlap in the graph, for all possible orientations of the fragments (see add_edges_from_match for details): - ``(1, 2, '1[8:14]:2[1:7]')`` - ``(2, 1, '2[1:7]:1[8:14]')`` - ``(-1, -2, '-1[0:6]:-2[10:16]')`` - ``(-2, -1, '-2[10:16]:-1[0:6]')`` An assembly can be thought of as a tuple of graph edges, but instead of representing them with node indexes and keys, we represent them as u, v, locu, locv, where u and v are the nodes connected by the edge, and locu and locv are the locations of the overlap in the first and second fragment. Assemblies are then represented as: - Linear: ((1, 2, [8:14], [1:7]), (2, 3, [10:17], [1:8])) - Circular: ((1, 2, [8:14], [1:7]), (2, 3, [10:17], [1:8]), (3, 1, [12:17], [1:6])) Note that the first and last fragment are the same in a circular assembly. The following constrains are applied to remove duplicate assemblies: - Circular assemblies: the first subfragment is not reversed, and has the smallest index in the input fragment list. use_fragment_order is ignored. - Linear assemblies: - Using uid (see add_edges_from_match) to identify unique edges. Parameters ---------- frags : list A list of Dseqrecord objects. limit : int, optional The shortest shared homology to be considered, this is passed as the third argument to the ``algorithm`` function. For certain algorithms, this might be ignored. algorithm : function, optional The algorithm used to determine the shared sequences. It's a function that takes two Dseqrecord objects as inputs, and will get passed the third argument (limit), that may or may not be used. It must return a list of overlaps (see common_sub_strings for an example). use_fragment_order : bool, optional It's set to True by default to reproduce legacy pydna behaviour: only assemblies that start with the first fragment and end with the last are considered. You should set it to False. use_all_fragments : bool, optional Constrain the assembly to use all fragments. Examples -------- from assembly2 import Assembly, assembly2str from pydna.dseqrecord import Dseqrecord example_fragments = ( Dseqrecord('AacgatCAtgctcc', name='a'), Dseqrecord('TtgctccTAAattctgc', name='b'), Dseqrecord('CattctgcGAGGacgatG', name='c'), ) asm = Assembly(example_fragments, limit=5, use_fragment_order=False) print('Linear ===============') for assembly in asm.get_linear_assemblies(): print(' ', assembly2str(assembly)) print('Circular =============') for assembly in asm.get_circular_assemblies(): print(' ', assembly2str(assembly)) # Prints Linear =============== ('1[8:14]:2[1:7]', '2[10:17]:3[1:8]') ('2[10:17]:3[1:8]', '3[12:17]:1[1:6]') ('3[12:17]:1[1:6]', '1[8:14]:2[1:7]') ('1[1:6]:3[12:17]',) ('2[1:7]:1[8:14]',) ('3[1:8]:2[10:17]',) Circular ============= ('1[8:14]:2[1:7]', '2[10:17]:3[1:8]', '3[12:17]:1[1:6]') """ def __init__( self, frags: list[Dseqrecord], limit: int = 25, algorithm: AssemblyAlgorithmType = common_sub_strings, use_fragment_order: bool = True, use_all_fragments: bool = False, ): # TODO: allow for the same fragment to be included more than once? self.G = nx.MultiDiGraph() # Add positive and negative nodes for forward and reverse fragments self.G.add_nodes_from((i + 1, {"seq": f}) for (i, f) in enumerate(frags)) self.G.add_nodes_from( (-(i + 1), {"seq": f.reverse_complement()}) for (i, f) in enumerate(frags) ) # Iterate over all possible combinations of fragments fragment_pairs = itertools.combinations( filter(lambda x: x > 0, self.G.nodes), 2 ) for i, j in fragment_pairs: # All the relative orientations of the fragments in the pair for u, v in itertools.product([i, -i], [j, -j]): u_seq = self.G.nodes[u]["seq"] v_seq = self.G.nodes[v]["seq"] matches = algorithm(u_seq, v_seq, limit) for match in matches: self.add_edges_from_match(match, u, v, u_seq, v_seq) self.fragments = frags self.limit = limit self.algorithm = algorithm self.use_fragment_order = use_fragment_order self.use_all_fragments = use_all_fragments return
[docs] @classmethod def assembly_is_valid( cls, fragments: list[Dseqrecord | Primer], assembly: EdgeRepresentationAssembly, is_circular: bool, use_all_fragments: bool, is_insertion: bool = False, ) -> bool: """ Returns True if the assembly is valid, False otherwise. See function comments for conditions tested. """ if is_circular is None: return False # Linear assemblies may get begin-1-end, begin-2-end, these are removed here. if len(assembly) == 0: return False # Topology check -> Circular sequences cannot be first or last in a linear assembly. # For example, let's imagine aACGTc (linear) and gACGTc (circular). # It should not be possible to join them into a linear assembly. It's similar if we # think of a restriction-ligation assembly, example: aGAATTCc (linear) and gGAATTCc # (circular). # A linear product can be generated where the circular molecule is cut open, and one end # it joins the linear molecule and on the other it's free, but for now it's not a # relevant product and it's excluded. first_fragment = fragments[abs(assembly[0][0]) - 1] last_fragment = fragments[abs(assembly[-1][1]) - 1] if not is_circular and ( isinstance(first_fragment, Dseqrecord) and first_fragment.circular or (isinstance(last_fragment, Dseqrecord) and last_fragment.circular) ): return False if use_all_fragments and len(fragments) != len( set(flatten(map(abs, e[:2]) for e in assembly)) ): return False # Here we check whether subsequent pairs of fragments are compatible, for instance: # Compatible (overlap of 1 and 2 occurs before overlap of 2 and 3): # (1,2,[2:9],[0:7]), (2,3,[12:19],[0:7]) # -- A -- # 1 gtatcgtgt -- B -- # 2 atcgtgtactgtcatattc # 3 catattcaa # Incompatible (overlap of 1 and 2 occurs after overlap of 2 and 3): # (1,2,[2:9],[13:20]), (2,3,[0:7],[0:7]) # -- A -- # 1 -- B -- gtatcgtgt # 2 catattcccccccatcgtgtactgt # 3 catattcaa # Redundant: overlap of 1 and 2 ends at the same spot as overlap of 2 and 3 # (1,2,[2:9],[1:8]), (2,3,[0:8],[0:8]) # -- A -- # gtatcgtgt # catcgtgtactgtcatattc # catcgtgtactgtcatattc # -- B --- if is_circular: # In a circular assembly, first and last fragment must be the same if assembly[0][0] != assembly[-1][1]: return False edge_pairs = zip(assembly, assembly[1:] + assembly[:1]) else: edge_pairs = zip(assembly, assembly[1:]) for (_u1, v1, _, start_location), (_u2, _v2, end_location, _) in edge_pairs: # Incompatible as described in figure above fragment = fragments[abs(v1) - 1] if ( isinstance(fragment, Primer) or not fragment.circular ) and location_boundaries(start_location)[1] >= location_boundaries( end_location )[ 1 ]: return False # Fragments are used only once nodes_used = [ f[0] for f in edge_representation2subfragment_representation( assembly, is_circular or is_insertion ) ] if len(nodes_used) != len(set(map(abs, nodes_used))): return False return True
[docs] def add_edges_from_match( self, match: SequenceOverlap, u: int, v: int, first: Dseqrecord, secnd: Dseqrecord, ): """Add edges to the graph from a match returned by the ``algorithm`` function (see pydna.common_substrings). For format of edges (see documentation of the Assembly class). Matches are directional, because not all ``algorithm`` functions return the same match for (u,v) and (v,u). For example, homologous recombination does but sticky end ligation does not. The function returns two edges: - Fragments in the orientation they were passed, with locations of the match (u, v, loc_u, loc_v) - Reverse complement of the fragments with inverted order, with flipped locations (-v, -u, flip(loc_v), flip(loc_u))/ """ x_start, y_start, length = match if length == 0: # Edge case, blunt ligation locs = [SimpleLocation(x_start, x_start), SimpleLocation(y_start, y_start)] else: # We use shift_location with 0 to wrap origin-spanning features locs = [ shift_location( SimpleLocation(x_start, x_start + length), 0, len(first) ), shift_location( SimpleLocation(y_start, y_start + length), 0, len(secnd) ), ] # Flip the locations to get the reverse complement rc_locs = [locs[0]._flip(len(first)), locs[1]._flip(len(secnd))] # Unique id that identifies the edge in either orientation uid = f"{u}{locs[0]}:{v}{locs[1]}" combinations = ( (u, v, locs), (-v, -u, rc_locs[::-1]), ) for u, v, l in combinations: self.G.add_edge(u, v, f"{u}{l[0]}:{v}{l[1]}", locations=l, uid=uid)
[docs] def format_assembly_edge( self, graph_edge: tuple[int, int, str] ) -> AssemblyEdgeType: """Go from the (u, v, key) to the (u, v, locu, locv) format.""" u, v, key = graph_edge locu, locv = self.G.get_edge_data(u, v, key)["locations"] return u, v, locu, locv
[docs] def get_linear_assemblies( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[EdgeRepresentationAssembly]: """Get linear assemblies, applying the constrains described in __init__, ensuring that paths represent real assemblies (see assembly_is_valid). Subassemblies are removed (see remove_subassemblies). """ # Copy the graph since we will add the begin and end mock nodes G = nx.MultiDiGraph(self.G) G.add_nodes_from(["begin", "end"]) if self.use_fragment_order: # Path must start with the first fragment and end with the last G.add_edge("begin", 1) G.add_edge("begin", -1) G.add_edge(len(self.fragments), "end") G.add_edge(-len(self.fragments), "end") else: for node in filter(lambda x: type(x) is int, G.nodes): G.add_edge("begin", node) G.add_edge(node, "end") unique_linear_paths = self.get_unique_linear_paths(G) possible_assemblies = self.get_possible_assembly_number(unique_linear_paths) if possible_assemblies > max_assemblies: raise ValueError( f"Too many assemblies ({possible_assemblies} pre-validation) to assemble" ) assemblies = sum( map(lambda x: self.node_path2assembly_list(x, False), unique_linear_paths), [], ) out = [ a for a in assemblies if self.assembly_is_valid(self.fragments, a, False, self.use_all_fragments) ] if only_adjacent_edges: out = [a for a in out if self.assembly_uses_only_adjacent_edges(a, False)] return remove_subassemblies(out)
[docs] def node_path2assembly_list( self, cycle: list[int], circular: bool ) -> list[EdgeRepresentationAssembly]: """Convert a node path in the format [1, 2, 3] (as returned by networkx.cycles.simple_cycles) to a list of all possible assemblies. There may be multiple assemblies for a given node path, if there are several edges connecting two nodes, for example two overlaps between 1 and 2, and single overlap between 2 and 3 should return 3 assemblies. """ combine = list() pairing = ( zip(cycle, cycle[1:] + cycle[:1]) if circular else zip(cycle, cycle[1:]) ) for u, v in pairing: combine.append([(u, v, key) for key in self.G[u][v]]) return [ tuple(map(self.format_assembly_edge, x)) for x in itertools.product(*combine) ]
[docs] def get_unique_linear_paths( self, G_with_begin_end: nx.MultiDiGraph, max_paths=10000 ) -> list[list[int]]: """Get unique linear paths from the graph, removing those that contain the same node twice.""" # We remove the begin and end nodes, and get all paths without edges # e.g. we will get [1, 2, 3] only once, even if multiple edges connect # 1 and 2 or 2 and 3, by converting to DiGraph. # Cutoff has a different meaning of what one would expect, see https://github.com/networkx/networkx/issues/2762 node_paths = [ x[1:-1] for x in limit_iterator( nx.all_simple_paths( nx.DiGraph(G_with_begin_end), "begin", "end", cutoff=(len(self.fragments) + 1), ), max_paths, ) ] # Remove those that contain the same node twice node_paths = [x for x in node_paths if len(x) == len(set(map(abs, x)))] if self.use_all_fragments: node_paths = [x for x in node_paths if len(x) == len(self.fragments)] # For each path, we check if there are reverse complement duplicates # See: https://github.com/manulera/OpenCloning_backend/issues/160 unique_node_paths = list() for p in node_paths: if [-x for x in p[::-1]] not in unique_node_paths: unique_node_paths.append(p) return unique_node_paths
[docs] def get_possible_assembly_number(self, paths: list[list[int]]) -> int: """ Get the number of possible assemblies from a list of node paths. Basically, for each path passed as a list of integers / nodes, we calculate the number of paths possible connecting the nodes in that order, given the graph (all the edges connecting them). """ possibilities = 0 for path in paths: this_path = 1 for u, v in zip(path, path[1:]): if v in self.G[u]: this_path *= len(self.G[u][v]) possibilities += this_path return possibilities
[docs] def get_circular_assemblies( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[EdgeRepresentationAssembly]: """Get circular assemblies, applying the constrains described in __init__, ensuring that paths represent real assemblies (see assembly_is_valid).""" # The constrain of circular sequence is that the first node is the fragment with the smallest index in its initial orientation, # this is ensured by the circular_permutation_min_abs function + the filter below sorted_cycles = map( circular_permutation_min_abs, limit_iterator( nx.cycles.simple_cycles(self.G, length_bound=len(self.fragments)), 10000, ), ) sorted_cycles = filter(lambda x: x[0] > 0, sorted_cycles) # cycles.simple_cycles returns lists [1,2,3] not assemblies, see self.cycle2circular_assemblies # We apply constrains already here because sometimes the combinatorial explosion is too large if self.use_all_fragments: sorted_cycles = [c for c in sorted_cycles if len(c) == len(self.fragments)] # Remove cycles with duplicates sorted_cycles = [c for c in sorted_cycles if len(c) == len(set(map(abs, c)))] possible_assembly_number = self.get_possible_assembly_number( [c + c[:1] for c in sorted_cycles] ) if possible_assembly_number > max_assemblies: raise ValueError( f"Too many assemblies ({possible_assembly_number} pre-validation) to assemble" ) assemblies = sum( map(lambda x: self.node_path2assembly_list(x, True), sorted_cycles), [] ) out = [ a for a in assemblies if self.assembly_is_valid(self.fragments, a, True, self.use_all_fragments) ] if only_adjacent_edges: out = [a for a in out if self.assembly_uses_only_adjacent_edges(a, True)] return out
[docs] def format_insertion_assembly( self, assembly: EdgeRepresentationAssembly ) -> EdgeRepresentationAssembly | None: """Sorts the fragment representing a cycle so that they represent an insertion assembly if possible, else returns None. Here we check if one of the joins between fragments represents the edges of an insertion assembly The fragment must be linear, and the join must be as indicated below :: -------- ------- Fragment 1 || || xxxxxxxx || Fragment 2 || || oooooooooo Fragment 3 The above example will be [(1, 2, [4:6], [0:2]), (2, 3, [6:8], [0:2]), (3, 1, [8:10], [9:11)])] These could be returned in any order by simple_cycles, so we sort the edges so that the first and last ``u`` and ``v`` match the fragment that gets the insertion (1 in the example above). """ edge_pair_index = list() # Pair edges with one another for i, ((_u1, v1, _, end_location), (_u2, _v2, start_location, _)) in enumerate( zip(assembly, assembly[1:] + assembly[:1]) ): fragment = self.fragments[abs(v1) - 1] # Find the pair of edges that should be last and first ((3, 1, [8:10], [9:11)]), (1, 2, [4:6], [0:2]) in # the example above. Only one of the pairs of edges should satisfy this condition for the topology to make sense. left_of_insertion = location_boundaries(start_location)[0] right_of_insertion = location_boundaries(end_location)[0] if not fragment.circular and ( right_of_insertion >= left_of_insertion # The below condition is for single-site integration. # The reason to use locations_overlap instead of equality is because the location might extend # left of right. For example, let's take ACCGGTTT as homology arm for an integration: # # insert aaACCGGTTTccACCGGTTTtt # genome aaACCGGTTTtt # # The locations of homology on the genome are [0:10] and [2:12], so not identical # but they overlap. or locations_overlap(start_location, end_location, len(fragment)) ): edge_pair_index.append(i) if len(edge_pair_index) != 1: return None shift_by = (edge_pair_index[0] + 1) % len(assembly) return assembly[shift_by:] + assembly[:shift_by]
[docs] def format_insertion_assembly_edge_case( self, assembly: EdgeRepresentationAssembly ) -> EdgeRepresentationAssembly: """ Edge case from https://github.com/manulera/OpenCloning_backend/issues/329 """ same_assembly = assembly[:] if len(assembly) != 2: return same_assembly ((f1, f2, loc_f1_1, loc_f2_1), (_f2, _f1, loc_f2_2, loc_f1_2)) = assembly if f1 != _f1 or _f2 != f2: return same_assembly if loc_f2_1 == loc_f2_2 or loc_f1_2 == loc_f1_1: return same_assembly fragment1 = self.fragments[abs(f1) - 1] fragment2 = self.fragments[abs(f2) - 1] if not locations_overlap( loc_f1_1, loc_f1_2, len(fragment1) ) or not locations_overlap(loc_f2_2, loc_f2_1, len(fragment2)): return same_assembly # Sort to make compatible with insertion assembly if location_boundaries(loc_f1_1)[0] > location_boundaries(loc_f1_2)[0]: new_assembly = same_assembly[::-1] else: new_assembly = same_assembly[:] ((f1, f2, loc_f1_1, loc_f2_1), (_f2, _f1, loc_f2_2, loc_f1_2)) = new_assembly fragment1 = self.fragments[abs(f1) - 1] if fragment1.circular: return same_assembly fragment2 = self.fragments[abs(f2) - 1] # Extract boundaries f2_1_start, _ = location_boundaries(loc_f2_1) f2_2_start, f2_2_end = location_boundaries(loc_f2_2) f1_1_start, _ = location_boundaries(loc_f1_1) f1_2_start, f1_2_end = location_boundaries(loc_f1_2) overlap_diff = len(fragment1[f1_1_start:f1_2_end]) - len( fragment2[f2_1_start:f2_2_end] ) # Safeguard if overlap_diff == 0: # pragma: no cover raise AssertionError("Overlap is 0") if overlap_diff > 0: new_loc_f1_1 = create_location( f1_1_start, f1_2_start - overlap_diff, len(fragment1) ) new_loc_f2_1 = create_location(f2_1_start, f2_2_start, len(fragment2)) else: new_loc_f2_1 = create_location( f2_1_start, f2_2_start + overlap_diff, len(fragment2) ) new_loc_f1_1 = create_location(f1_1_start, f1_2_start, len(fragment1)) new_assembly = [ (f1, f2, new_loc_f1_1, new_loc_f2_1), new_assembly[1], ] return new_assembly
[docs] def get_insertion_assemblies( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[EdgeRepresentationAssembly]: """Assemblies that represent the insertion of a fragment or series of fragment inside a linear construct. For instance, digesting CCCCGAATTCCCCGAATTC with EcoRI and inserting the fragment with two overhangs into the EcoRI site of AAAGAATTCAAA. This is not so much meant for the use-case of linear fragments that represent actual linear fragments, but for linear fragments that represent a genome region. This can then be used to simulate homologous recombination. """ if only_adjacent_edges: raise NotImplementedError( "only_adjacent_edges not implemented for insertion assemblies" ) cycles = limit_iterator(nx.cycles.simple_cycles(self.G), 10000) # We apply constrains already here because sometimes the combinatorial explosion is too large if self.use_all_fragments: cycles = [c for c in cycles if len(c) == len(self.fragments)] # Remove cycles with duplicates cycles = [c for c in cycles if len(c) == len(set(map(abs, c)))] possible_assembly_number = self.get_possible_assembly_number( [c + c[:1] for c in cycles] ) if possible_assembly_number > max_assemblies: raise ValueError( f"Too many assemblies ({possible_assembly_number} pre-validation) to assemble" ) # We find cycles first iterator = limit_iterator(nx.cycles.simple_cycles(self.G), 10000) assemblies = sum( map(lambda x: self.node_path2assembly_list(x, True), iterator), [] ) # We format the edge case assemblies = [self.format_insertion_assembly_edge_case(a) for a in assemblies] # We select those that contain exactly only one suitable edge assemblies = [ b for a in assemblies if (b := self.format_insertion_assembly(a)) is not None ] # First fragment should be in the + orientation assemblies = list(filter(lambda x: x[0][0] > 0, assemblies)) return [ a for a in assemblies if self.assembly_is_valid( self.fragments, a, False, self.use_all_fragments, is_insertion=True ) ]
[docs] def assemble_linear( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[Dseqrecord]: """Assemble linear constructs, from assemblies returned by self.get_linear_assemblies.""" assemblies = self.get_linear_assemblies(only_adjacent_edges, max_assemblies) return [assemble(self.fragments, a) for a in assemblies]
[docs] def assemble_circular( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[Dseqrecord]: """Assemble circular constructs, from assemblies returned by self.get_circular_assemblies.""" assemblies = self.get_circular_assemblies(only_adjacent_edges, max_assemblies) return [assemble(self.fragments, a) for a in assemblies]
[docs] def assemble_insertion(self, only_adjacent_edges: bool = False) -> list[Dseqrecord]: """Assemble insertion constructs, from assemblies returned by self.get_insertion_assemblies.""" assemblies = self.get_insertion_assemblies(only_adjacent_edges) return [assemble(self.fragments, a, is_insertion=True) for a in assemblies]
[docs] def get_locations_on_fragments(self) -> dict[int, dict[str, list[Location]]]: """Get a dictionary where the keys are the nodes in the graph, and the values are dictionaries with keys ``left``, ``right``, containing (for each fragment) the locations where the fragment is joined to another fragment on its left and right side. The values in ``left`` and ``right`` are often the same, except in restriction-ligation with partial overlap enabled, where we can end up with a situation like this: GGTCTCCCCAATT and aGGTCTCCAACCAA as fragments # Partial overlap in assembly 1[9:11]:2[8:10] GGTCTCCxxAACCAA CCAGAGGGGTTxxTT # Partial overlap in 2[10:12]:1[7:9] aGGTCTCCxxCCAATT tCCAGAGGTTGGxxAA Would return:: { 1: {'left': [7:9], 'right': [9:11]}, 2: {'left': [8:10], 'right': [10:12]}, -1: {'left': [2:4], 'right': [4:6]}, -2: {'left': [2:4], 'right': [4:6]} } """ locations_on_fragments = dict() for node in self.G.nodes: this_dict = {"left": list(), "right": list()} for edge in self.G.edges(data=True): for i, key in enumerate(["right", "left"]): if edge[i] == node: edge_location = edge[2]["locations"][i] if edge_location not in this_dict[key]: this_dict[key].append(edge_location) this_dict["left"] = sorted( this_dict["left"], key=lambda x: location_boundaries(x)[0] ) this_dict["right"] = sorted( this_dict["right"], key=lambda x: location_boundaries(x)[0] ) locations_on_fragments[node] = this_dict return locations_on_fragments
[docs] def assembly_uses_only_adjacent_edges(self, assembly, is_circular: bool) -> bool: """ Check whether only adjacent edges within each fragment are used in the assembly. This is useful to check if a cut and ligate assembly is valid, and prevent including partially digested fragments. For example, imagine the following fragment being an input for a digestion and ligation assembly, where the enzyme cuts at the sites indicated by the vertical lines: :: x y z -------|-------|-------|--------- We would only want assemblies that contain subfragments start-x, x-y, y-z, z-end, and not start-x, y-end, for instance. The latter would indicate that the fragment was partially digested. """ locations_on_fragments = self.get_locations_on_fragments() for node in locations_on_fragments: fragment_len = len(self.fragments[abs(node) - 1]) for side in ["left", "right"]: locations_on_fragments[node][side] = gather_overlapping_locations( locations_on_fragments[node][side], fragment_len ) allowed_location_pairs = dict() for node in locations_on_fragments: if not is_circular: # We add the existing ends of the fragment left = [(None,)] + locations_on_fragments[node]["left"] right = locations_on_fragments[node]["right"] + [(None,)] else: # For circular assemblies, we add the first location at the end # to allow for the last edge to be used left = locations_on_fragments[node]["left"] right = ( locations_on_fragments[node]["right"][1:] + locations_on_fragments[node]["right"][:1] ) pairs = list() for pair in zip(left, right): pairs += list(itertools.product(*pair)) allowed_location_pairs[node] = pairs fragment_assembly = edge_representation2subfragment_representation( assembly, is_circular ) for node, start_location, end_location in fragment_assembly: if (start_location, end_location) not in allowed_location_pairs[node]: return False return True
def __repr__(self): # https://pyformat.info return ps( "Assembly\n" "fragments..: {sequences}\n" "limit(bp)..: {limit}\n" "G.nodes....: {nodes}\n" "algorithm..: {al}".format( sequences=" ".join("{}bp".format(len(x)) for x in self.fragments), limit=self.limit, nodes=self.G.order(), al=self.algorithm.__name__, ) )
[docs] class PCRAssembly(Assembly): """ An assembly that represents a PCR, where ``fragments`` is a list of primer, template, primer (in that order). It always uses the ``primer_template_overlap`` algorithm and accepts the ``mismatches`` argument to indicate the number of mismatches allowed in the overlap. Only supports substitution mismatches, not indels. """ def __init__(self, frags: list[Dseqrecord | Primer], limit=25, mismatches=0): value_error = ValueError( "PCRAssembly assembly must be initialised with a list/tuple of primer, template, primer" ) if len(frags) != 3: raise value_error # Validate the inputs: should be a series of primer, template, primer wrong_fragment_class = ( not isinstance(frags[0], Primer), isinstance(frags[1], Primer), not isinstance(frags[2], Primer), ) if any(wrong_fragment_class): raise value_error # TODO: allow for the same fragment to be included more than once? self.G = nx.MultiDiGraph() # Add positive and negative nodes for forward and reverse fragments self.G.add_nodes_from((i + 1, {"seq": f}) for (i, f) in enumerate(frags)) self.G.add_nodes_from( (-(i + 1), {"seq": f.reverse_complement()}) for (i, f) in enumerate(frags) ) pairs = list() primer_ids = list() for i in range(0, len(frags), 3): # primer, template, primer p1, t, p2 = (i + 1, i + 2, i + 3) primer_ids += [p1, p2] pairs += list(itertools.product([p1, p2], [t, -t])) pairs += list(itertools.product([t, -t], [-p1, -p2])) for u, v in pairs: u_seq = self.G.nodes[u]["seq"] v_seq = self.G.nodes[v]["seq"] matches = primer_template_overlap(u_seq, v_seq, limit, mismatches) for match in matches: self.add_edges_from_match(match, u, v, u_seq, v_seq) # These two are constrained self.use_fragment_order = False self.use_all_fragments = True self.fragments = frags self.limit = limit self.algorithm = primer_template_overlap return
[docs] def get_linear_assemblies( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[EdgeRepresentationAssembly]: if only_adjacent_edges: raise NotImplementedError( "only_adjacent_edges not implemented for PCR assemblies" ) return super().get_linear_assemblies(max_assemblies=max_assemblies)
[docs] def get_circular_assemblies(self, only_adjacent_edges: bool = False): raise NotImplementedError( "get_circular_assemblies not implemented for PCR assemblies" )
[docs] def get_insertion_assemblies(self, only_adjacent_edges: bool = False): raise NotImplementedError( "get_insertion_assemblies not implemented for PCR assemblies" )
[docs] def assemble_linear( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[Dseqrecord]: """ Overrides the parent method to ensure that the 5' of the crick strand of the product matches the sequence of the reverse primer. This is important when using primers with dUTP (for USER cloning). """ results = super().assemble_linear(only_adjacent_edges, max_assemblies) for result in results: rp = self.fragments[2] result.seq = result.seq[: -len(rp)] + Dseq(str(rp.seq.reverse_complement())) return results
[docs] class SingleFragmentAssembly(Assembly): """ An assembly that represents the circularisation or splicing of a single fragment. """ def __init__(self, frags: [Dseqrecord], limit=25, algorithm=common_sub_strings): if len(frags) != 1: raise ValueError( "SingleFragmentAssembly assembly must be initialised with a single fragment" ) # TODO: allow for the same fragment to be included more than once? self.G = nx.MultiDiGraph() frag = frags[0] # Add positive and negative nodes for forward and reverse fragments self.G.add_node(1, seq=frag) matches = algorithm(frag, frag, limit) # Remove matches where the whole sequence matches matches = [match for match in matches if match[2] != len(frag)] for match in matches: self.add_edges_from_match(match, 1, 1, frag, frag) # To avoid duplicated outputs while (-1, -1) in self.G.edges(): self.G.remove_edges_from([(-1, -1)]) # These two are constrained self.use_fragment_order = True self.use_all_fragments = True self.fragments = frags self.limit = limit self.algorithm = algorithm return
[docs] def get_circular_assemblies( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[EdgeRepresentationAssembly]: # We don't want the same location twice assemblies = filter( lambda x: x[0][2] != x[0][3], super().get_circular_assemblies(only_adjacent_edges, max_assemblies), ) return [ a for a in assemblies if self.assembly_is_valid(self.fragments, a, True, self.use_all_fragments) ]
[docs] def get_insertion_assemblies( self, only_adjacent_edges: bool = False, max_assemblies: int = 50 ) -> list[EdgeRepresentationAssembly]: """This could be renamed splicing assembly, but the essence is similar""" if only_adjacent_edges: raise NotImplementedError( "only_adjacent_edges not implemented for insertion assemblies" ) def splicing_assembly_filter(x): # We don't want the same location twice if x[0][2] == x[0][3]: return False # We don't want to get overlap only (e.g. GAATTCcatGAATTC giving GAATTC) left_start, _ = location_boundaries(x[0][2]) _, right_end = location_boundaries(x[0][3]) if left_start == 0 and right_end == len(self.fragments[0]): return False return True # We don't want the same location twice assemblies = filter( splicing_assembly_filter, super().get_insertion_assemblies(max_assemblies=max_assemblies), ) return [ a for a in assemblies if self.assembly_is_valid( self.fragments, a, False, self.use_all_fragments, is_insertion=True ) ]
[docs] def get_linear_assemblies(self): raise NotImplementedError("Linear assembly does not make sense")
[docs] def common_function_assembly_products( frags: list[Dseqrecord], limit: int | None, algorithm: Callable, circular_only: bool, filter_results_function: Callable | None = None, only_adjacent_edges: bool = False, ) -> list[Dseqrecord]: """Common function to avoid code duplication. Could be simplified further once SingleFragmentAssembly and Assembly are merged. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble limit : int or None Minimum overlap length required, or None if not applicable algorithm : Callable Function that determines valid overlaps between fragments circular_only : bool If True, only return circular assemblies filter_results_function : Callable or None Function that filters the results only_adjacent_edges : bool If True, only return assemblies that use only adjacent edges Returns ------- list[Dseqrecord] List of assembled DNA molecules """ if len(frags) == 1: asm = SingleFragmentAssembly(frags, limit, algorithm) else: asm = Assembly( frags, limit, algorithm, use_fragment_order=False, use_all_fragments=True ) output_assemblies = asm.get_circular_assemblies(only_adjacent_edges) if not circular_only and len(frags) > 1: output_assemblies += filter_linear_subassemblies( asm.get_linear_assemblies(only_adjacent_edges), output_assemblies, frags ) if not circular_only and len(frags) == 1: output_assemblies += asm.get_insertion_assemblies() if filter_results_function: output_assemblies = [a for a in output_assemblies if filter_results_function(a)] return [assemble(frags, a) for a in output_assemblies]
def _recast_sources( products: list[Dseqrecord], source_cls, **extra_fields ) -> list[Dseqrecord]: """Recast the `source` of each product to `source_cls` with optional extras. This avoids repeating the same for-loop across many assembly functions. """ for prod in products: prod.source = source_cls( **prod.source.to_unserialized_dict(), **extra_fields, ) return products
[docs] def gibson_assembly( frags: list[Dseqrecord], limit: int = 25, circular_only: bool = False ) -> list[Dseqrecord]: """Returns the products for Gibson assembly. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble limit : int, optional Minimum overlap length required, by default 25 circular_only : bool, optional If True, only return circular assemblies, by default False Returns ------- list[Dseqrecord] List of assembled DNA molecules """ products = common_function_assembly_products( frags, limit, gibson_overlap, circular_only ) return _recast_sources(products, GibsonAssemblySource)
[docs] def in_fusion_assembly( frags: list[Dseqrecord], limit: int = 25, circular_only: bool = False ) -> list[Dseqrecord]: """Returns the products for in-fusion assembly. This is the same as Gibson assembly, but with a different name. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble limit : int, optional Minimum overlap length required, by default 25 circular_only : bool, optional If True, only return circular assemblies, by default False Returns ------- list[Dseqrecord] List of assembled DNA molecules """ products = common_function_assembly_products( frags, limit, in_fusion_overlap, circular_only ) return _recast_sources(products, InFusionSource)
[docs] def fusion_pcr_assembly( frags: list[Dseqrecord], limit: int = 25, circular_only: bool = False ) -> list[Dseqrecord]: """Returns the products for fusion PCR assembly. This is the same as Gibson assembly, but with a different name. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble limit : int, optional Minimum overlap length required, by default 25 circular_only : bool, optional If True, only return circular assemblies, by default False Returns ------- list[Dseqrecord] List of assembled DNA molecules """ products = common_function_assembly_products( frags, limit, pcr_fusion_overlap, circular_only ) return _recast_sources(products, OverlapExtensionPCRLigationSource)
[docs] def in_vivo_assembly( frags: list[Dseqrecord], limit: int = 25, circular_only: bool = False ) -> list[Dseqrecord]: """Returns the products for in vivo assembly (IVA), which relies on homologous recombination between the fragments. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble limit : int, optional Minimum overlap length required, by default 25 circular_only : bool, optional If True, only return circular assemblies, by default False Returns ------- list[Dseqrecord] List of assembled DNA molecules """ products = common_function_assembly_products( frags, limit, common_sub_strings, circular_only ) return _recast_sources(products, InVivoAssemblySource)
[docs] def restriction_ligation_assembly( frags: list[Dseqrecord], enzymes: list["AbstractCut"], allow_blunt: bool = True, circular_only: bool = False, ) -> list[Dseqrecord]: """Returns the products for restriction ligation assembly: - Finds cutsites in the fragments - Finds all products that could be assembled by ligating the fragments based on those cutsites - Will NOT return products that combine an existing end with an end generated by the same enzyme (see example below) Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble enzymes : list[AbstractCut] List of restriction enzymes to use allow_blunt : bool, optional If True, allow blunt end ligations, by default True circular_only : bool, optional If True, only return circular assemblies, by default False Returns ------- list[Dseqrecord] List of assembled DNA molecules Examples -------- In the example below, we plan to assemble a plasmid from a backbone and an insert, using the EcoRI and SalI enzymes. Note how 2 circular products are returned, one contains the insert (``acgt``) and the desired part of the backbone (``cccccc``), the other contains the reversed insert (``tgga``) and the cut-out part of the backbone (``aaa``). >>> from pydna.assembly2 import restriction_ligation_assembly >>> from pydna.dseqrecord import Dseqrecord >>> from Bio.Restriction import EcoRI, SalI >>> backbone = Dseqrecord("cccGAATTCaaaGTCGACccc", circular=True) >>> insert = Dseqrecord("ggGAATTCaggtGTCGACgg") >>> products = restriction_ligation_assembly([backbone, insert], [EcoRI, SalI], circular_only=True) >>> products[0].seq Dseq(o22) TCGACccccccGAATTCaggtG AGCTGggggggCTTAAGtccaC >>> products[1].seq Dseq(o19) AATTCaaaGTCGACacctG TTAAGtttCAGCTGtggaC Note that passing a pre-cut fragment will not work. >>> restriction_products = insert.cut([EcoRI, SalI]) >>> cut_insert = restriction_products[1] >>> restriction_ligation_assembly([backbone, cut_insert], [EcoRI, SalI], circular_only=True) [] It also works with a single fragment, for circularization: >>> seq = Dseqrecord("GAATTCaaaGAATTC") >>> products =restriction_ligation_assembly([seq], [EcoRI]) >>> products[0].seq Dseq(o9) AATTCaaaG TTAAGtttC """ def algorithm_fn(x, y, _l): # By default, we allow blunt ends return restriction_ligation_overlap(x, y, enzymes, False, allow_blunt) products = common_function_assembly_products( frags, None, algorithm_fn, circular_only, only_adjacent_edges=True ) return _recast_sources( products, RestrictionAndLigationSource, restriction_enzymes=enzymes )
[docs] def golden_gate_assembly( frags: list[Dseqrecord], enzymes: list["AbstractCut"], allow_blunt: bool = True, circular_only: bool = False, ) -> list[Dseqrecord]: """Returns the products for Golden Gate assembly. This is the same as restriction ligation assembly, but with a different name. Check the documentation for ``restriction_ligation_assembly`` for more details. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble enzymes : list[AbstractCut] List of restriction enzymes to use allow_blunt : bool, optional If True, allow blunt end ligations, by default True circular_only : bool, optional If True, only return circular assemblies, by default False Returns ------- list[Dseqrecord] List of assembled DNA molecules Examples -------- See the example for ``restriction_ligation_assembly``. """ return restriction_ligation_assembly(frags, enzymes, allow_blunt, circular_only)
[docs] def ligation_assembly( frags: list[Dseqrecord], allow_blunt: bool = False, allow_partial_overlap: bool = False, circular_only: bool = False, ) -> list[Dseqrecord]: """Returns the products for ligation assembly, as inputs pass the fragments (digested if needed) that will be ligated. For most cases, you probably should use ``restriction_ligation_assembly`` instead. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble allow_blunt : bool, optional If True, allow blunt end ligations, by default False allow_partial_overlap : bool, optional If True, allow partial overlaps between sticky ends, by default False circular_only : bool, optional If True, only return circular assemblies, by default False Returns ------- list[Dseqrecord] List of assembled DNA molecules Examples -------- In the example below, we plan to assemble a plasmid from a backbone and an insert, using the EcoRI enzyme. The insert and insertion site in the backbone are flanked by EcoRI sites, so there are two possible products depending on the orientation of the insert. >>> from pydna.assembly2 import ligation_assembly >>> from pydna.dseqrecord import Dseqrecord >>> from Bio.Restriction import EcoRI >>> backbone = Dseqrecord("cccGAATTCaaaGAATTCccc", circular=True) >>> backbone_cut = backbone.cut(EcoRI)[1] >>> insert = Dseqrecord("ggGAATTCaggtGAATTCgg") >>> insert_cut = insert.cut(EcoRI)[1] >>> products = ligation_assembly([backbone_cut, insert_cut]) >>> products[0].seq Dseq(o22) AATTCccccccGAATTCaggtG TTAAGggggggCTTAAGtccaC >>> products[1].seq Dseq(o22) AATTCccccccGAATTCacctG TTAAGggggggCTTAAGtggaC """ def sticky_end_algorithm(x, y, _l): return sticky_end_sub_strings(x, y, allow_partial_overlap) if allow_blunt: algorithm_fn = combine_algorithms(sticky_end_algorithm, blunt_overlap) else: algorithm_fn = sticky_end_algorithm products = common_function_assembly_products( frags, None, algorithm_fn, circular_only ) return _recast_sources(products, LigationSource)
[docs] def assembly_is_multi_site(asm: list[EdgeRepresentationAssembly]) -> bool: """Returns True if the assembly is a multi-site assembly, False otherwise.""" if len(asm) < 2: return False is_cycle = asm[0][1] == asm[-1][0] asm2 = edge_representation2subfragment_representation(asm, is_cycle) return all(f[1] != f[2] for f in asm2)
[docs] def gateway_assembly( frags: list[Dseqrecord], reaction_type: Literal["BP", "LR"], greedy: bool = False, circular_only: bool = False, multi_site_only: bool = False, ) -> list[Dseqrecord]: """Returns the products for Gateway assembly / Gateway cloning. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to assemble reaction_type : Literal['BP', 'LR'] Type of Gateway reaction greedy : bool, optional If True, use greedy gateway consensus sites, by default False circular_only : bool, optional If True, only return circular assemblies, by default False multi_site_only : bool, optional If True, only return products that where 2 sites recombined. Even if input sequences contain multiple att sites (typically 2), a product could be generated where only one site recombines. That's typically not what you want, so you can set this to True to only return products where both att sites recombined. Returns ------- list[Dseqrecord] List of assembled DNA molecules Examples -------- Below an example with dummy Gateway sequences, composed with minimal sequences and the consensus att sites. >>> from pydna.assembly2 import gateway_assembly >>> from pydna.dseqrecord import Dseqrecord >>> attB1 = "ACAACTTTGTACAAAAAAGCAGAAG" >>> attP1 = "AAAATAATGATTTTATTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGAACGAGAAGCGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTA" >>> attR1 = "ACAACTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATG" >>> attL1 = "CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGCAGGCT" >>> seq1 = Dseqrecord("aaa" + attB1 + "ccc") >>> seq2 = Dseqrecord("aaa" + attP1 + "ccc") >>> seq3 = Dseqrecord("aaa" + attR1 + "ccc") >>> seq4 = Dseqrecord("aaa" + attL1 + "ccc") >>> products_BP = gateway_assembly([seq1, seq2], "BP") >>> products_LR = gateway_assembly([seq3, seq4], "LR") >>> len(products_BP) 2 >>> len(products_LR) 2 Now let's understand the ``multi_site_only`` parameter. Let's consider a case where we are swapping fragments between two plasmids using an LR reaction. Experimentally, we expect to obtain two plasmids, resulting from the swapping between the two att sites. That's what we get if we set ``multi_site_only`` to True. >>> attL2 = 'aaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgctttcttataatgccaactttgtacaagaaagctg' >>> attR2 = 'accactttgtacaagaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatg' >>> insert = Dseqrecord("cccccc" + attL1 + "ccc" + attL2 + "cccccc", circular=True) >>> backbone = Dseqrecord("ttttt" + attR1 + "aaa" + attR2, circular=True) >>> products = gateway_assembly([insert, backbone], "LR", multi_site_only=True) >>> len(products) 2 However, if we set ``multi_site_only`` to False, we get 4 products, which also include the intermediate products where the two plasmids are combined into a single one through recombination of a single att site. This is an intermediate of the reaction, and typically we don't want it: >>> products = gateway_assembly([insert, backbone], "LR", multi_site_only=False) >>> print([len(p) for p in products]) [469, 237, 232, 469] """ if reaction_type not in ["BP", "LR"]: raise ValueError( f"Invalid reaction type: {reaction_type}, can only be BP or LR" ) def algorithm_fn(x, y, _l): return gateway_overlap(x, y, reaction_type, greedy) filter_results_function = None if not multi_site_only else assembly_is_multi_site products = common_function_assembly_products( frags, None, algorithm_fn, circular_only, filter_results_function ) products = _recast_sources( products, GatewaySource, reaction_type=reaction_type, greedy=greedy, ) if len(products) == 0: # Build a list of all the sites in the fragments sites_in_fragments = list() for frag in frags: sites_in_fragments.append(list(find_gateway_sites(frag, greedy).keys())) formatted_strings = [ f'fragment {i + 1}: {", ".join(sites)}' for i, sites in enumerate(sites_in_fragments) ] raise ValueError( f"Inputs are not compatible for {reaction_type} reaction.\n\n" + "\n".join(formatted_strings), ) return products
[docs] def common_function_integration_products( frags: list[Dseqrecord], limit: int | None, algorithm: Callable ) -> list[Dseqrecord]: """Common function to avoid code duplication for integration products. Parameters ---------- frags : list[Dseqrecord] List of DNA fragments to integrate limit : int or None Minimum overlap length required, or None if not applicable algorithm : Callable Function that determines valid overlaps between fragments Returns ------- list[Dseqrecord] List of integrated DNA molecules """ if len(frags) == 1: asm = SingleFragmentAssembly(frags, limit, algorithm) else: asm = Assembly( frags, limit, algorithm, use_fragment_order=False, use_all_fragments=True ) if frags[0].circular: raise ValueError( "Genome must be linear for integration assembly, use in vivo assembly instead" ) # We only want insertions in the genome (first fragment) output_assemblies = [a for a in asm.get_insertion_assemblies() if a[0][0] == 1] return [assemble(frags, a, True) for a in output_assemblies]
[docs] def common_handle_insertion_fragments( genome: Dseqrecord, inserts: list[Dseqrecord] ) -> list[Dseqrecord]: """Common function to handle / validate insertion fragments. Parameters ---------- genome : Dseqrecord Target genome sequence inserts : list[Dseqrecord] or Dseqrecord DNA fragment(s) to insert Returns ------- list[Dseqrecord] List containing genome and insert fragments """ if not isinstance(genome, Dseqrecord): raise ValueError("Genome must be a Dseqrecord object") if not isinstance(inserts, list) or not all( isinstance(f, Dseqrecord) for f in inserts ): raise ValueError("Inserts must be a list of Dseqrecord objects") if len(inserts) == 0: raise ValueError("Inserts must be a non-empty list of Dseqrecord objects") return [genome] + inserts
[docs] def common_function_excision_products( genome: Dseqrecord, limit: int | None, algorithm: Callable ) -> list[Dseqrecord]: """Common function to avoid code duplication for excision products. Parameters ---------- genome : Dseqrecord Target genome sequence limit : int or None Minimum overlap length required, or None if not applicable algorithm : Callable Function that determines valid overlaps between fragments Returns ------- list[Dseqrecord] List of excised DNA molecules """ asm = SingleFragmentAssembly([genome], limit, algorithm) return asm.assemble_circular() + asm.assemble_insertion()
[docs] def homologous_recombination_integration( genome: Dseqrecord, inserts: list[Dseqrecord], limit: int = 40, ) -> list[Dseqrecord]: """Returns the products resulting from the integration of an insert (or inserts joined through in vivo recombination) into the genome through homologous recombination. Parameters ---------- genome : Dseqrecord Target genome sequence inserts : list[Dseqrecord] DNA fragment(s) to insert limit : int, optional Minimum homology length required, by default 40 Returns ------- list[Dseqrecord] List of integrated DNA molecules Examples -------- Below an example with a single insert. >>> from pydna.assembly2 import homologous_recombination_integration >>> from pydna.dseqrecord import Dseqrecord >>> homology = "AAGTCCGTTCGTTTTACCTG" >>> genome = Dseqrecord(f"aaaaaa{homology}ccccc{homology}aaaaaa") >>> insert = Dseqrecord(f"{homology}gggg{homology}") >>> products = homologous_recombination_integration(genome, [insert], 20) >>> str(products[0].seq) 'aaaaaaAAGTCCGTTCGTTTTACCTGggggAAGTCCGTTCGTTTTACCTGaaaaaa' Below an example with two inserts joined through homology. >>> homology2 = "ATTACAGCATGGGAAGAAAGA" >>> insert_1 = Dseqrecord(f"{homology}gggg{homology2}") >>> insert_2 = Dseqrecord(f"{homology2}cccc{homology}") >>> products = homologous_recombination_integration(genome, [insert_1, insert_2], 20) >>> str(products[0].seq) 'aaaaaaAAGTCCGTTCGTTTTACCTGggggATTACAGCATGGGAAGAAAGAccccAAGTCCGTTCGTTTTACCTGaaaaaa' """ fragments = common_handle_insertion_fragments(genome, inserts) products = common_function_integration_products( fragments, limit, common_sub_strings ) return _recast_sources(products, HomologousRecombinationSource)
[docs] def homologous_recombination_excision( genome: Dseqrecord, limit: int = 40 ) -> list[Dseqrecord]: """Returns the products resulting from the excision of a fragment from the genome through homologous recombination. Parameters ---------- genome : Dseqrecord Target genome sequence limit : int, optional Minimum homology length required, by default 40 Returns ------- list[Dseqrecord] List containing excised plasmid and remaining genome sequence Examples -------- Example of a homologous recombination event, where a plasmid is excised from the genome (circular sequence of 25 bp), and that part is removed from the genome, leaving a shorter linear sequence (32 bp). >>> from pydna.assembly2 import homologous_recombination_excision >>> from pydna.dseqrecord import Dseqrecord >>> homology = "AAGTCCGTTCGTTTTACCTG" >>> genome = Dseqrecord(f"aaaaaa{homology}ccccc{homology}aaaaaa") >>> products = homologous_recombination_excision(genome, 20) >>> products [Dseqrecord(o25), Dseqrecord(-32)] """ products = common_function_excision_products(genome, limit, common_sub_strings) return _recast_sources(products, HomologousRecombinationSource)
[docs] def cre_lox_integration( genome: Dseqrecord, inserts: list[Dseqrecord] ) -> list[Dseqrecord]: """Returns the products resulting from the integration of an insert (or inserts joined through cre-lox recombination among them) into the genome through cre-lox integration. Also works with lox66 and lox71 (see ``pydna.cre_lox`` for more details). Parameters ---------- genome : Dseqrecord Target genome sequence inserts : list[Dseqrecord] or Dseqrecord DNA fragment(s) to insert Returns ------- list[Dseqrecord] List of integrated DNA molecules Examples -------- Below an example of reversible integration and excision. >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.assembly2 import cre_lox_integration, cre_lox_excision >>> from pydna.cre_lox import LOXP_SEQUENCE >>> a = Dseqrecord(f"cccccc{LOXP_SEQUENCE}aaaaa") >>> b = Dseqrecord(f"{LOXP_SEQUENCE}bbbbb", circular=True) >>> [a, b] [Dseqrecord(-45), Dseqrecord(o39)] >>> res = cre_lox_integration(a, [b]) >>> res [Dseqrecord(-84)] >>> res2 = cre_lox_excision(res[0]) >>> res2 [Dseqrecord(o39), Dseqrecord(-45)] Below an example with lox66 and lox71 (irreversible integration). Here, the result of excision is still returned because there is a low probability of it happening, but it's considered a rare event. >>> lox66 = 'ATAACTTCGTATAGCATACATTATACGAACGGTA' >>> lox71 = 'TACCGTTCGTATAGCATACATTATACGAAGTTAT' >>> a = Dseqrecord(f"cccccc{lox66}aaaaa") >>> b = Dseqrecord(f"{lox71}bbbbb", circular=True) >>> res = cre_lox_integration(a, [b]) >>> res [Dseqrecord(-84)] >>> res2 = cre_lox_excision(res[0]) >>> res2 [Dseqrecord(o39), Dseqrecord(-45)] """ fragments = common_handle_insertion_fragments(genome, inserts) products = common_function_integration_products(fragments, None, cre_loxP_overlap) return _recast_sources(products, CreLoxRecombinationSource)
[docs] def cre_lox_excision(genome: Dseqrecord) -> list[Dseqrecord]: """Returns the products for CRE-lox excision. Parameters ---------- genome : Dseqrecord Target genome sequence Returns ------- list[Dseqrecord] List containing excised plasmid and remaining genome sequence Examples -------- Below an example of reversible integration and excision. >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.assembly2 import cre_lox_integration, cre_lox_excision >>> from pydna.cre_lox import LOXP_SEQUENCE >>> a = Dseqrecord(f"cccccc{LOXP_SEQUENCE}aaaaa") >>> b = Dseqrecord(f"{LOXP_SEQUENCE}bbbbb", circular=True) >>> [a, b] [Dseqrecord(-45), Dseqrecord(o39)] >>> res = cre_lox_integration(a, [b]) >>> res [Dseqrecord(-84)] >>> res2 = cre_lox_excision(res[0]) >>> res2 [Dseqrecord(o39), Dseqrecord(-45)] Below an example with lox66 and lox71 (irreversible integration). Here, the result of excision is still returned because there is a low probability of it happening, but it's considered a rare event. >>> lox66 = 'ATAACTTCGTATAGCATACATTATACGAACGGTA' >>> lox71 = 'TACCGTTCGTATAGCATACATTATACGAAGTTAT' >>> a = Dseqrecord(f"cccccc{lox66}aaaaa") >>> b = Dseqrecord(f"{lox71}bbbbb", circular=True) >>> res = cre_lox_integration(a, [b]) >>> res [Dseqrecord(-84)] >>> res2 = cre_lox_excision(res[0]) >>> res2 [Dseqrecord(o39), Dseqrecord(-45)] """ products = common_function_excision_products(genome, None, cre_loxP_overlap) return _recast_sources(products, CreLoxRecombinationSource)
[docs] def recombinase_excision( genome: Dseqrecord, recombinase: Recombinase, ) -> list[Dseqrecord]: """Returns the products for recombinase-mediated excision. Parameters ---------- genome : Dseqrecord Target genome sequence containing two recombinase sites. recombinase : Recombinase Recombinase object. Returns ------- list[Dseqrecord] List containing excised plasmid and remaining genome sequence. """ products = common_function_excision_products(genome, None, recombinase.overlap) products = [recombinase.annotate(p) for p in products] return _recast_sources(products, RecombinaseSource)
[docs] def recombinase_integration( genome: Dseqrecord, inserts: list[Dseqrecord], recombinase: Recombinase, ) -> list[Dseqrecord]: """Returns the products resulting from recombinase-mediated integration. Parameters ---------- genome : Dseqrecord Target genome sequence. inserts : list[Dseqrecord] DNA fragment(s) to insert. recombinase : Recombinase Recombinase object. Returns ------- list[Dseqrecord] List of integrated DNA molecules. Examples -------- >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.assembly2 import recombinase_integration, recombinase_excision >>> from pydna.recombinase import Recombinase >>> site1 = "ATGCCCTAAaaTT" >>> site2 = "AAaaTTTTTTTCCCT" >>> genome = Dseqrecord(f"cccccc{site1.upper()}aaaaa") >>> insert = Dseqrecord(f"{site2.upper()}bbbbb", circular=True) >>> recombinase = Recombinase(site1, site2) >>> products = recombinase_integration(genome, [insert], recombinase) >>> len(products) >= 1 True """ fragments = common_handle_insertion_fragments(genome, inserts) products = common_function_integration_products( fragments, None, recombinase.overlap ) products = [recombinase.annotate(p) for p in products] return _recast_sources(products, RecombinaseSource)
[docs] def crispr_integration( genome: Dseqrecord, inserts: list[Dseqrecord], guides: list[Primer], limit: int = 40, ) -> list[Dseqrecord]: """ Returns the products for CRISPR integration. Parameters ---------- genome : Dseqrecord Target genome sequence inserts : list[Dseqrecord] DNA fragment(s) to insert guides : list[Primer] List of guide RNAs as Primer objects. This may change in the future. limit : int, optional Minimum overlap length required, by default 40 Returns ------- list[Dseqrecord] List of integrated DNA molecules Examples -------- >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.assembly2 import crispr_integration >>> from pydna.primer import Primer >>> genome = Dseqrecord("aaccggttcaatgcaaacagtaatgatggatgacattcaaagcac", name="genome") >>> insert = Dseqrecord("aaccggttAAAAAAAAAttcaaagcac", name="insert") >>> guide = Primer("ttcaatgcaaacagtaatga", name="guide") >>> product, *_ = crispr_integration(genome, [insert], [guide], 8) >>> product Dseqrecord(-27) """ if len(guides) == 0: raise ValueError("At least one guide RNA is required for CRISPR integration") # Get all the possible products from the homologous recombination integration products = homologous_recombination_integration(genome, inserts, limit) # Verify that the guides cut in the region that will be repaired # First we collect the positions where the guides cut guide_cuts = [] for guide in guides: enzyme = cas9(str(guide.seq)) possible_cuts = genome.seq.get_cutsites(enzyme) if len(possible_cuts) == 0: raise ValueError( f"Could not find Cas9 cutsite in the target sequence using the guide: {guide.name}" ) # Keep only the position of the cut possible_cuts = [cut[0] for (cut, _) in possible_cuts] guide_cuts.append(possible_cuts) # Then, we check it the possible homologous recombination products contain the cuts # from the guides inside the repair region. # We also add the used guides to each product. This is very important! valid_products = [] for i, product in enumerate(products): # The second element of product.source.input is conventionally the insert/repair fragment # The other two (first and third) are the two bits of the genome repair_start = location_boundaries(product.source.input[0].right_location)[0] # Here we do +1 because the position of the cut marks the boundary (e.g. 0:10, 10:20 if a cut is at pos 10) repair_end = location_boundaries(product.source.input[2].left_location)[1] + 1 repair_location = create_location(repair_start, repair_end, len(genome)) some_cuts_inside_repair = [] all_cuts_inside_repair = [] for cut_group in guide_cuts: cuts_in_repair = [cut for cut in cut_group if cut in repair_location] some_cuts_inside_repair.append(len(cuts_in_repair) != 0) all_cuts_inside_repair.append(len(cuts_in_repair) == len(cut_group)) if all(some_cuts_inside_repair): used_guides = [g for i, g in enumerate(guides) if all_cuts_inside_repair[i]] # Add the used guides to the product <----- VERY IMPORTANT! product.source.input.extend([SourceInput(sequence=g) for g in used_guides]) valid_products.append(product) if not all(all_cuts_inside_repair): raise ValueError( "Some guides cut outside the repair region, please check the guides" ) if len(valid_products) != len(products): warnings.warn( "Some recombination products were discarded because they had off-target cuts", category=UserWarning, stacklevel=2, ) return _recast_sources(valid_products, CRISPRSource)
[docs] def pcr_assembly( template: Dseqrecord, fwd_primer: Primer, rvs_primer: Primer, add_primer_features: bool = False, limit: int = 14, mismatches: int = 0, ) -> list[Dseqrecord]: """Returns the products for PCR assembly. Parameters ---------- template : Dseqrecord Template sequence fwd_primer : Primer Forward primer rvs_primer : Primer Reverse primer add_primer_features : bool, optional If True, add primer features to the product, by default False limit : int, optional Minimum overlap length required, by default 14 mismatches : int, optional Maximum number of mismatches, by default 0 Returns ------- list[Dseqrecord] List of assembled DNA molecules """ minimal_annealing = limit + mismatches fragments = [fwd_primer, template, rvs_primer] asm = PCRAssembly( fragments, limit=minimal_annealing, mismatches=mismatches, ) products = asm.assemble_linear() # If both primers are the same, remove duplicates if str(fwd_primer.seq).upper() == str(rvs_primer.seq).upper(): products = [p for p in products if not p.source.input[1].reverse_complemented] if add_primer_features: products = [annotate_primer_binding_sites(prod, fragments) for prod in products] return _recast_sources(products, PCRSource, add_primer_features=add_primer_features)